Review



nature cell biology article  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc nature cell biology article
    Nature Cell Biology Article, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/CD63+GYEVI-pEGFP+C2+(Plasmid+%23101038)/pm41102449-588-0-35
    Average 94 stars, based on 73 article reviews
    nature cell biology article - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Epigenetic alterations facilitate transcriptional and translational programs in hypoxia.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-025-01786-8 To deplete endogenous PDK1, two guide RNAs (gRNAs) targeting exon 2 of hPDK1 (targeting GCAAGAGTTGCCTGTCAGACTGG and TTGCCGCAGAAACATAAATGAGG) were designed using CHOPCHOP102 and cloned into the lentiCRISPRv2 plasmid conferring G418 resistance (Addgene, #98292) according to the protocol by Zhang et al.103,104. .. Modifications included using BsmBI-v2 (NEB, R0739) for lentiCRISPRv2 digestion and an overnight ligation reaction at 4 °C.

    Plasmid Preparation:

    Article Title: Epigenetic alterations facilitate transcriptional and translational programs in hypoxia.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-025-01786-8 To deplete endogenous PDK1, two guide RNAs (gRNAs) targeting exon 2 of hPDK1 (targeting GCAAGAGTTGCCTGTCAGACTGG and TTGCCGCAGAAACATAAATGAGG) were designed using CHOPCHOP102 and cloned into the lentiCRISPRv2 plasmid conferring G418 resistance (Addgene, #98292) according to the protocol by Zhang et al.103,104. .. Modifications included using BsmBI-v2 (NEB, R0739) for lentiCRISPRv2 digestion and an overnight ligation reaction at 4 °C.

    Article Title: Polarized branched Actin modulates cortical mechanics to produce unequal-size daughters during asymmetric division.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-022-01058-9 • UAS-GFP::Cdc42: For the Cdc42 protein cloning, Cdc42 was amplified by PCR, flanked with FA digestion sites from the plasmid available from Addgene collection ID 52248 (pUASp YFP Cdc42 WT) and was inserted in C-ter into pUAST4 PC GFP FA plasmid pre-digested by FA for insertion of the Cdc42 FA fragment. .. The plasmid was then was sent to BestGene to be injected into w1118 background Drosophila embryo to generate transgenics.

    Cloning:

    Article Title: Polarized branched Actin modulates cortical mechanics to produce unequal-size daughters during asymmetric division.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-022-01058-9 • UAS-GFP::Cdc42: For the Cdc42 protein cloning, Cdc42 was amplified by PCR, flanked with FA digestion sites from the plasmid available from Addgene collection ID 52248 (pUASp YFP Cdc42 WT) and was inserted in C-ter into pUAST4 PC GFP FA plasmid pre-digested by FA for insertion of the Cdc42 FA fragment. .. The plasmid was then was sent to BestGene to be injected into w1118 background Drosophila embryo to generate transgenics.

    Amplification:

    Article Title: Polarized branched Actin modulates cortical mechanics to produce unequal-size daughters during asymmetric division.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-022-01058-9 • UAS-GFP::Cdc42: For the Cdc42 protein cloning, Cdc42 was amplified by PCR, flanked with FA digestion sites from the plasmid available from Addgene collection ID 52248 (pUASp YFP Cdc42 WT) and was inserted in C-ter into pUAST4 PC GFP FA plasmid pre-digested by FA for insertion of the Cdc42 FA fragment. .. The plasmid was then was sent to BestGene to be injected into w1118 background Drosophila embryo to generate transgenics.

    Polymerase Chain Reaction:

    Article Title: Polarized branched Actin modulates cortical mechanics to produce unequal-size daughters during asymmetric division.
    Article Snippet: .. Nature Cell Biology Article https://doi.org/10.1038/s41556-022-01058-9 • UAS-GFP::Cdc42: For the Cdc42 protein cloning, Cdc42 was amplified by PCR, flanked with FA digestion sites from the plasmid available from Addgene collection ID 52248 (pUASp YFP Cdc42 WT) and was inserted in C-ter into pUAST4 PC GFP FA plasmid pre-digested by FA for insertion of the Cdc42 FA fragment. .. The plasmid was then was sent to BestGene to be injected into w1118 background Drosophila embryo to generate transgenics.



    Similar Products

    secon dary antibodies nature cell biology article  (LI-COR)
    99
    LI-COR secon dary antibodies nature cell biology article
    Secon Dary Antibodies Nature Cell Biology Article, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/GOATaMOUSE+IRDye+680RD/pm40921733-366-16-25
    Average 99 stars, based on 1 article reviews
    secon dary antibodies nature cell biology article - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    nanoject ii microinjector nature cell biology article  (Drummond Scientific)
    86
    Drummond Scientific nanoject ii microinjector nature cell biology article
    Nanoject Ii Microinjector Nature Cell Biology Article, supplied by Drummond Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/article+biology+cell+ii+microinjector+nanoject+nature/pm41366519-596-17-25
    Average 86 stars, based on 1 article reviews
    nanoject ii microinjector nature cell biology article - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    nature cell biology article  (Addgene inc)
    94
    Addgene inc nature cell biology article
    Nature Cell Biology Article, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/CD63+GYEVI-pEGFP+C2+(Plasmid+%23101038)/pm41102449-588-0-35
    Average 94 stars, based on 1 article reviews
    nature cell biology article - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    equal protein nature cell biology article  (Bio-Rad)
    99
    Bio-Rad equal protein nature cell biology article
    Equal Protein Nature Cell Biology Article, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/Protein+Standard+I/pm40983659-518-0-17
    Average 99 stars, based on 1 article reviews
    equal protein nature cell biology article - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    antibodies oct4 nature cell biology article  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology antibodies oct4 nature cell biology article
    Antibodies Oct4 Nature Cell Biology Article, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/Oct-3%2F4+Antibody/pm40921733-499-21-29
    Average 96 stars, based on 1 article reviews
    antibodies oct4 nature cell biology article - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    nature cell biology article  (Bio-Rad)
    96
    Bio-Rad nature cell biology article
    Nature Cell Biology Article, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/Nitrocellulose+Membrane%2E+0%2E45+%CE%9Cm/pm40579455-363-10-17
    Average 96 stars, based on 1 article reviews
    nature cell biology article - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    stop nature structural molecular biology article  (Cell Signaling Technology Inc)
    99
    Cell Signaling Technology Inc stop nature structural molecular biology article
    Stop Nature Structural Molecular Biology Article, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/Cell+Lysis+Buffer/pm40247146-431-9-30
    Average 99 stars, based on 1 article reviews
    stop nature structural molecular biology article - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    phostag nature cell biology article gels  (FUJIFILM)
    90
    FUJIFILM phostag nature cell biology article gels
    Phostag Nature Cell Biology Article Gels, supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/supersep+phostag+gels/pm39805921-258-4-11
    Average 90 stars, based on 1 article reviews
    phostag nature cell biology article gels - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dmi8 inverted nature cell biology article  (Danaher Inc)
    99
    Danaher Inc dmi8 inverted nature cell biology article
    Dmi8 Inverted Nature Cell Biology Article, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nature+cell+biology+article/DMi8+S+Inverted+Microscope+Solution/pm39779939-423-15-24
    Average 99 stars, based on 1 article reviews
    dmi8 inverted nature cell biology article - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results